98%
921
2 minutes
20
Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.
Download full-text PDF |
Source |
---|---|
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC9099682 | PMC |
http://dx.doi.org/10.3390/molecules27092997 | DOI Listing |
iScience
September 2025
Biophysics Department, GSI Helmholtzzentrum für Schwerionenforschung GmbH, Darmstadt, Hessen, Germany.
Efforts to efficiently target brain tumors are constrained by the dearth of appropriate models to study tumor behavior toward treatment approaches as well as potential side effects to the surrounding normal tissue. We established a reproducible cerebral organoid model of brain tumorigenesis in an autologous setting by overexpressing , a common oncogene in brain tumors. GFP/c-MYC cells were isolated from tumor organoids and used in two different approaches: GFP/c-MYC cells co-cultured with cerebral organoid slices or fused as spheres to whole organoids.
View Article and Find Full Text PDFFront Biosci (Landmark Ed)
August 2025
Department of Hepatobiliary Surgery, General Hospital of Ningxia Medical University, 750004 Yinchuan, Ningxia Hui Autonomous Region, China.
Background: Mediator complex subunit 10 (MED10) serves as a critical regulator of eukaryotic gene expression by facilitating RNA polymerase II activity. Our investigation aims to characterize MED10's functional contributions and underlying molecular pathways in hepatocellular carcinoma (HCC) development.
Methods: MED10 expression patterns in HCC and their correlation with clinicopathological parameters and patient outcomes were examined using bioinformatics databases and immunohistochemistry.
Front Biosci (Landmark Ed)
August 2025
General Surgery, Shanghai Pudong New District Traditional Chinese Medicine Hospital, 200120 Shanghai, China.
Background: The most common endocrine cancer, thyroid carcinoma (TC), has a dismal prognosis when it reaches an advanced stage. Integrin α-2 () has been implicated in cancer progression, influencing both DNA damage and repair mechanisms. However, it is unknown how ITGA2 influences these processes in TC.
View Article and Find Full Text PDFSci Immunol
September 2025
Laboratory of Epigenetics and Immunology, West China Institute of Women and Children's Health, NHC Key Laboratory of Chronobiology, State Key Laboratory of Biotherapy, West China Second University Hospital, Sichuan University, Chengdu, China.
Naïve T cells are maintained in a homeostatic state to preserve a stable T cell pool with diverse T cell receptor (TCR) repertoires, ensuring preparedness for priming. However, the underlying mechanisms controlling naïve T cell homeostasis and priming remain unclear. Leveraging a machine learning-based functional genetic screen, we identified () as the top factor responsible for naïve T cell homeostasis.
View Article and Find Full Text PDFBiology (Basel)
August 2025
Department of Medical Technology, Faculty of Associated Medical Sciences, Chiang Mai University, Chiang Mai 50200, Thailand.
The c-Myc protein, a key regulator of cell proliferation, growth, and apoptosis in B-cell lymphocytes, is frequently dysregulated in Burkitt's lymphoma. Zingiberaceae plants-galangal (), black turmeric (), black ginger (), phlai lueang (), and phlai dum ()-are traditionally used as herbal remedies and may serve as natural anti-lymphoma agents. In this study, extracts from these five plants were screened for cytotoxicity against Raji and Daudi lymphoma cell lines and compared with their effects on normal peripheral blood mononuclear cells (PBMCs).
View Article and Find Full Text PDF