The identification of reliable biomarkers is essential for improving breast cancer (BC) detection, prognosis, and treatment. This study explores a human telomeric G-quadruplex (G4) model, tel, functionalized on Controlled Pore Glass (CPG) support, as a novel biomarker discovery tool. The oligonucleotide tel mimics multimeric G4 structures in telomeric overhangs.
View Article and Find Full Text PDFThe synthesis and characterization of a mini-library of cyclic triimidazo triazine (TT) derivatives functionalized with one, two, or three ethynyl-N-methyl-pyridinium moieties are reported here. These compounds were designed with the aim of targeting cancer-related DNA G-quadruplex structures. The newly synthesized compounds were tested for their ability to bind G-quadruplexes from both telomeric and oncogene promoter sequences using an affinity chromatography-based assay, spectroscopic and electrophoretic techniques, as well as molecular docking analysis.
View Article and Find Full Text PDFLack of specificity towards cancer cells is a major drawback of most chemotherapeutic agents. The use of selective drug delivery systems capable of targeting cancer cells is a valuable perspective to overcome the serious adverse effects often associated with conventional treatments. In this frame, N-acetylgalactosamine (GalNAc)-functionalized G-quadruplex-forming oligonucleotides represent promising delivery systems due to their ability to selectively recognize the asialoglycoprotein receptor (ASGPR) overexpressed on the surface of hepatocellular carcinoma cells.
View Article and Find Full Text PDFInt J Biol Macromol
December 2024
In this work, we present the case of the G-quadruplex(G4)-forming aptamers we recently identified for the recognition of HMGB1, protein involved in inflammation, autoimmune diseases and cancer. These aptamers were previously analyzed, without annealing them, after proper dilution of the stock solution in a pseudo-physiological buffer mimicking the extracellular environment where the protein exerts its pathological activity, and showed high thermal stability and nuclease resistance, good protein affinity and remarkable in vitro activity. These features were more marked for the aptamers forming dimeric, parallel G4 structures in solution.
View Article and Find Full Text PDFIn the search for novel, effective inhibitors of High-Mobility Group Box1 (HMGB1)-a protein involved in various inflammatory and autoimmune diseases as well as in cancer-we herein discovered a set of anti-HMGB1 G-quadruplex(G4)-forming aptamers by using an in vitro selection procedure applied to a doped library of guanine-rich oligonucleotides. The selected DNA sequences were then studied in a pseudo-physiological buffer mimicking the extracellular medium, where HMGB1 exerts its pathological activity, using spectroscopic, electrophoretic, and chromatographic techniques. All the oligonucleotides proved to fold into monomeric G4s and in some cases also dimeric species, stable at physiological temperature.
View Article and Find Full Text PDFRu-based chemotherapy is emerging as an effective alternative to the well-established Pt-based one, typically associated with high toxicity. In this context, our recent efforts were devoted to the preparation of nucleolipid-based Ru(III) complexes able to form, under physiological conditions, supramolecular aggregates which can efficiently prevent metal deactivation and convey Ru(III) inside the cells where it exerts its activity. Within an interdisciplinary program for the development of multifunctional nanoparticles for theranostic applications, we here report the design, synthesis, and characterization of a novel functionalized Ru(III) salt, carrying a lipoic acid moiety in the nucleolipid-based scaffold to allow its incorporation onto metal-based nanoparticles.
View Article and Find Full Text PDFIn-depth studies on the interaction of natural compounds with cancer-related G-quadruplex structures have been undertaken only recently, despite their high potential as anticancer agents, especially due to their well-known and various bioactivities. In this frame, aiming at expanding the repertoire of natural compounds able to selectively recognize G-quadruplexes, and particularly focusing on phenanthrenoids, a mini-library including dimeric (-) and glucoside (-) analogues of 9,10-dihydrophenanthrenes, a related tetrahydropyrene glucoside () along with 9,10-dihydrophenanthrene were investigated here by several biophysical techniques and molecular docking. Compounds and emerged as the most selective G-quadruplex ligands within the investigated series.
View Article and Find Full Text PDFAiming to identify highly effective and selective G-quadruplex ligands as anticancer candidates, five natural compounds were investigated here, i.e., the alkaloids Canadine, D-Glaucine and Dicentrine, as well as the flavonoids Deguelin and Millettone, selected as analogs of compounds previously identified as promising G-quadruplex-targeting ligands.
View Article and Find Full Text PDFG-quadruplexes turned out to be important targets for the development of novel targeted anticancer/antiviral therapies. More than 3000 G-quadruplex small-molecule ligands have been described, with most of them exerting anticancer/antiviral activity by inducing telomeric damage and/or altering oncogene or viral gene expression in cancer cells and viruses, respectively. For some ligands, in-depth NMR and/or crystallographic studies were performed, providing detailed knowledge on their interactions with diverse G-quadruplex targets.
View Article and Find Full Text PDFInt J Biol Macromol
January 2023
To develop efficient anticancer theranostic systems, we studied the interaction between a cyanine dye, analogue of thiazole orange (named CyOH), and two G-quadruplex-forming aptamers, V7t1 and 3R02, recognizing the Vascular Endothelial Growth Factor 165 (VEGF) - an angiogenic protein overexpressed in cancer cells, responsible for the rapid growth and metastases of solid tumours. We demonstrated, by exploiting different biophysical techniques - i.e.
View Article and Find Full Text PDFHypoxia plays a crucial role in tumorigenesis and drug resistance, and it is recognised as a major factor affecting patient clinical outcome. Therefore, the detection of hypoxic areas within the tumour micro-environment represents a useful way to monitor tumour growth and patients' responses to treatments, properly guiding the choice of the most suitable therapy. To date, non-invasive hypoxia imaging probes have been identified, but their applicability is strongly limited due to an inadequate resistance to the low oxygen concentration and the acidic pH of the tumour micro-environment.
View Article and Find Full Text PDFLipid-conjugated Ru(III) complexes - designed to obtain lipophilic analogues of the low molecular weight derivative AziRu, which is a NAMI-A-like anticancer agent - have been synthesized and fully characterized. A detailed biophysical investigation, including multiple, integrated techniques, allowed determining their molecular and self-assembling properties in aqueous solutions mimicking the extracellular environment, showing that our design produced a protective effect from hydrolysis of the Ru(III) complexes. In vitro biological experiments, carried out in comparison with AziRu, demonstrated that, among the novel lipophilic Ru(III) complexes synthesized, the compounds derivatized with palmitic and stearic acid, that we named PalmiPyRu and StePyRu respectively, showed attractive features and a promising antiproliferative activity, selective on specific breast cancer phenotypes.
View Article and Find Full Text PDFDNA G-quadruplexes (G4s) are key structures for the development of targeted anticancer therapies. In this context, ligands selectively interacting with G4s can represent valuable anticancer drugs. Aiming at speeding up the identification of G4-targeting synthetic or natural compounds, we developed an affinity chromatography-based assay, named G-quadruplex on Oligo Affinity Support (G4-OAS), by synthesizing G4-forming sequences on commercially available polystyrene OAS.
View Article and Find Full Text PDFTrans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation.
View Article and Find Full Text PDFAiming at discovering novel, putative anticancer drugs featuring low-to-null side effects, natural compounds isolated from were studied here for their ability to target G-quadruplex structures originating from cancer-related telomeric and oncogene DNA sequences. Particularly, various dihydrophenanthrene, benzocoumarin and dihydrodibenzoxepin derivatives were firstly screened by the affinity chromatography-based G4-CPG assay, and the compound with the highest affinity and selectivity for G-quadruplexes (named J10) was selected for further studies. Fluorescence spectroscopy and circular dichroism experiments corroborated its capability to selectively recognize and stabilize G-quadruplexes over duplex DNA, also showing a preference for parallel G-quadruplexes.
View Article and Find Full Text PDFG-quadruplex existence was proved in cells by using both antibodies and small molecule fluorescent probes. However, the G-quadruplex probes designed thus far are structure- but not conformation-specific. Recently, a core-extended naphthalene diimide () was designed and found to provide fluorescent signals of markedly different intensities when bound to G-quadruplexes of different conformations or duplexes.
View Article and Find Full Text PDFBiomolecules
July 2021
In the search for new therapeutic strategies to contrast SARS-CoV-2, we here studied the interaction of polydatin (PD) and resveratrol (RESV)-two natural stilbene polyphenols with manifold, well known biological activities-with Spike, the viral protein essential for virus entry into host cells, and ACE2, the angiotensin-converting enzyme present on the surface of multiple cell types (including respiratory epithelial cells) which is the main host receptor for Spike binding. Molecular Docking simulations evidenced that both compounds can bind Spike, ACE2 and the ACE2:Spike complex with good affinity, although the interaction of PD appears stronger than that of RESV on all the investigated targets. Preliminary biochemical assays revealed a significant inhibitory activity of the ACE2:Spike recognition with a dose-response effect only in the case of PD.
View Article and Find Full Text PDFPeptides and their synthetic analogs are a class of molecules with enormous relevance as therapeutics for their ability to interact with biomacromolecules like nucleic acids and proteins, potentially interfering with biological pathways often involved in the onset and progression of pathologies of high social impact. Nucleobase-bearing peptides (nucleopeptides) and pseudopeptides (PNAs) offer further interesting possibilities related to their nucleobase-decorated nature for diagnostic and therapeutic applications, thanks to their reported ability to target complementary DNA and RNA strands. In addition, these chimeric compounds are endowed with intriguing self-assembling properties, which are at the heart of their investigation as self-replicating materials in prebiotic chemistry, as well as their application as constituents of innovative drug delivery systems and, more generally, as novel nanomaterials to be employed in biomedicine.
View Article and Find Full Text PDFIn the context of developing efficient anticancer therapies aimed at eradicating any sort of tumors, G-quadruplexes represent excellent targets. Small molecules able to interact with G-quadruplexes can interfere with cell pathways specific of tumors and common to all cancers. Naphthalene diimides (NDIs) are among the most promising, putative anticancer G-quadruplex-targeting drugs, due to their ability to simultaneously target multiple G-quadruplexes and their strong, selective in vitro and in vivo anticancer activity.
View Article and Find Full Text PDFBackground: Nucleopeptides are chimeric compounds of biomedical importance carrying DNA nucleobases anchored to peptide backbones with the ascertained capacity to bind nucleic acids. However, their ability to interact with proteins involved in pathologies of social relevance is a feature that still requires investigation. The worrying situation currently observed worldwide for the COVID-19 pandemic urgently requires the research on novel anti-SARSCoV- 2 molecular weapons, whose discovery can be aided by in silico predictive studies.
View Article and Find Full Text PDFMultivalent interactions frequently occur in biological systems and typically provide higher binding affinity and selectivity in target recognition than when only monovalent interactions are operative. Thus, taking inspiration by nature, bivalent or multivalent nucleic acid aptamers recognizing a specific biological target have been extensively studied in the last decades. Indeed, oligonucleotide-based aptamers are suitable building blocks for the development of highly efficient multivalent systems since they can be easily modified and assembled exploiting proper connecting linkers of different nature.
View Article and Find Full Text PDFInt J Biol Macromol
January 2021
To selectively target telomeric G-quadruplex (G4) DNA, monomeric and dimeric naphthalene diimides (NDIs) were investigated as binders of multimeric G4 structures able to discriminate duplex DNA. These NDIs were analysed by the affinity chromatography-based screening G4-CPG (G-quadruplex on Controlled Pore Glass), using the sequence d[AGGG(TTAGGG)] (tel46), folding into two consecutive G4s, as model of the human telomeric G4 multimer. In parallel, a telomeric G4 monomer (tel26) and a duplex structure (ds27) were used as controls.
View Article and Find Full Text PDFThe vascular endothelial growth factor (VEGF) family and its receptors play fundamental roles not only in physiological but also in pathological angiogenesis, characteristic of cancer progression. Aiming at finding putative treatments for several malignancies, various small molecules, antibodies, or protein-based drugs have been evaluated in vitro and in vivo as VEGF inhibitors, providing efficient agents approved for clinical use. Due to the high clinical importance of VEGF, also a great number of anti-VEGF nucleic acid-based aptamers-that is, oligonucleotides able to bind with high affinity and specificity a selected biological target-have been developed as promising agents in anticancer strategies.
View Article and Find Full Text PDFPharmaceuticals (Basel)
September 2020
We here report our studies on the reaction with the platinum(II) ion of a nucleoamino acid constituted by the l-2,3-diaminopropanoic acid linked to the thymine nucleobase through a methylenecarbonyl linker. The obtained new platinum complexes, characterized by spectroscopic and mass spectrometric techniques, were envisaged to exploit synergistic effects due to the presence of both the platinum center and the nucleoamino acid moiety. The latter can be potentially useful to protect the complexes from early deactivation, as well as to facilitate their cell internalization.
View Article and Find Full Text PDFFirst studies on thrombin-inhibiting DNA aptamers were reported in 1992, and since then a large number of anticoagulant aptamers has been discovered. TBA - also named HD1, a 15-mer G-quadruplex (G4)-forming oligonucleotide - is the best characterized thrombin binding aptamer, able to specifically recognize the protein exosite I, thus inhibiting the conversion of soluble fibrinogen into insoluble fibrin strands. Unmodified nucleic acid-based aptamers, in general, and TBA in particular, exhibit limited pharmacokinetic properties and are rapidly degraded in vivo by nucleases.
View Article and Find Full Text PDF