Cellular transfection using rapid decrease in hydrostatic pressure.

Of all methods exercised in modern molecular biology, modification of cellular properties through the introduction or removal of nucleic acids is one of the most fundamental. As such, several methods have arisen to promote this process; these include the condensation of nucleic acids with calcium, polyethylenimine or modified lipids, electroporation, viral production, biolistics, and microinjection. An ideal transfection method would be (1) low cost, (2) exhibit high levels of biological safety, (3) offer improved efficacy over existing methods, (4) lack requirements for ongoing consumables, (5) work efficiently at any scale, (6) work efficiently on cells that are difficult to transfect by other methods, and (7) be capable of utilizing the widest array of existing genetic resources to facilitate its utility in research, biotechnical and clinical settings.

Enhancement of the thermal stability of G-quadruplex structures by urea.

The solute urea has been used extensively as a denaturant in protein folding studies; double-stranded nucleic acid structures are also destabilized by urea, but comparatively less than proteins. In previous research, the solute has been shown to strongly destabilize folded G-quadruplex DNA structures. This contribution demonstrates the stabilizing effect of urea on the G-quadruplex formed by the oligodeoxyribonucleotide (ODN), G3T (d[5'-GGGTGGGTGGGTGGG-3']), and related sequences in the presence of sodium or potassium cations.

Clinical Translation of Long-Acting Drug Delivery Systems for Posterior Capsule Opacification Prophylaxis.

Posterior capsule opacification (PCO) remains the most common cause of vision loss post cataract surgery. The clinical management of PCO formation is limited to either physical impedance of residual lens epithelial cells (LECs) by implantation of specially designed intraocular lenses (IOL) or laser ablation of the opaque posterior capsular tissues; however, these strategies cannot fully eradicate PCO and are associated with other ocular complications. In this review, we critically appraise recent advances in conventional and nanotechnology-based drug delivery approaches to PCO prophylaxis.

Interaction of an anticancer benzopyrane derivative with DNA: Biophysical, biochemical, and molecular modeling studies.

Background: SIMR1281 is a potent anticancer lead candidate with multi- target activity against several proteins; however, its mechanism of action at the molecular level is not fully understood. Revealing the mechanism and the origin of multitarget activity is important for the rational identification and optimization of multitarget drugs.

Methods: We have used a variety of biophysical (circular dichroism, isothermal titration calorimetry, viscosity, and UV DNA melting), biochemical (topoisomerase I & II assays) and computational (molecular docking and MD simulations) methods to study the interaction of SIMR1281 with duplex DNA structures.

Blood-declustering excretable metal clusters assembled in DNA matrix.

We report polymeric DNA-supported gold clusters that achieve interparticle plasmon-coupling, generate immunotherapeutic effects at the tumor tissue, but decluster in the bloodstream. As immunostimulating DNA, we used polyCpG DNA, which could act as a supporting matrix for metal clusters, enabling the clusters to decluster in the bloodstream. We constructed polyCpG-supported gold nanoclusters (AuPCN).

The Pressure Dependence of the Stability of the G-quadruplex Formed by d(TGGGGT).

The G-quadruplex (GQ), a tetrahelix formed by guanine-rich nucleic acid sequences, is a potential drug target for several diseases. Monomolecular GQs are stabilized by guanine tetrads and non-guanine regions that form loops. Hydrostatic pressure destabilizes the folded, monomolecular GQ structures.

Dimethyl sulfoxide (DMSO) is a stabilizing co-solvent for G-quadruplex DNA.

We report the effect of dimethyl sulfoxide (DMSO) on the stability of the four-stranded structures formed by the oligodeoxyribonucleotides d[5'-AGGG(TTAGGG)-3'] (HTel), d[5'-(GGGT)GGG-3'] (G3T), d[5'-GGTTGGTGTGGTTGG-3] (TBA), d[5'-GGGGTTTTGGGG-3'] (Oxy-1.5), and d[5'-TGGGGT-3'] (TG4T). In these measurements, influence of the co-solvent was assessed by the change in the mid-point of the heat-induced unfolding, T, by monitoring the change in the UV absorption of the sample.

Volumetric Properties of Four-Stranded DNA Structures.

Four-stranded non-canonical DNA structures including G-quadruplexes and -motifs have been found in the genome and are thought to be involved in regulation of biological function. These structures have been implicated in telomere biology, genomic instability, and regulation of transcription and translation events. To gain an understanding of the molecular determinants underlying the biological role of four-stranded DNA structures, their biophysical properties have been extensively studied.

Volumetric Interplay between the Conformational States Adopted by Guanine-Rich DNA from the c-MYC Promoter.

The kinetic and thermodynamic stabilities of G-quadruplex structures have been extensively studied. In contrast, systematic investigations of the volumetric properties of G-quadruplexes determining their pressure stability are still relatively scarce. The G-rich strand from the promoter region of the c-MYC oncogene (G-strand) is known to adopt a range of conformational states including the duplex, G-quadruplex, and coil states depending on the presence of the complementary C-rich strand (C-strand) and solution conditions.

Duplex-tetraplex equilibria in guanine- and cytosine-rich DNA.

Noncanonical four-stranded DNA structures, including G-quadruplexes and i-motifs, have been discovered in the cell and are implicated in a variety of genomic regulatory functions. The tendency of a specific guanine- and cytosine-rich region of genomic DNA to adopt a four-stranded conformation depends on its ability to overcome the constraints of duplex base-pairing by undergoing consecutive duplex-to-coil and coil-to-tetraplex transitions. The latter ability is determined by the balance between the free energies of participating ordered and disordered structures.

Biochemical reprogramming of tumors for active modulation of receptor-mediated nanomaterial delivery.

Here we report that reactive oxygen species (ROS) can reprogram cancer cells to increase the expression of specific receptors and modulate the delivery of nanomaterials. Gold and γ-polyglutamic acid (γ-PGA) hybrid nanoparticles (PGANP) were prepared via a facile single-step process. Gold nanoclusters in PGANP were dispersed within the tangled γ-PGA matrix of the nanoparticles.

Sequential activation of anticancer therapy triggered by tumor microenvironment-selective imaging.

The combination of imaging and anticancer therapy has recently emerged as a promising strategy. However, nonspecific imaging signals and distribution of anticancer drugs at normal tissues limit the specificity of the combination therapy. To overcome the challenges, we designed a system which can selectively visualize cancer tissues and initiate the subsequent action of therapeutic molecules in tumor microenvironment.

On empirical decomposition of volumetric data.

Volumetric characterization of proteins and their recognition events has been instrumental in providing information on the role of intra- and intermolecular interactions, including hydration, in stabilizing biomolecules. The credibility of molecular models and interpretation schemes used to rationalize experimental data are essential for the validity of microscopic insights derived from volumetric results. Current empirical schemes used to interpret volumetric data suffer from a lack of theoretical and computational substantiation.

Stress-induced acidification may contribute to formation of unusual structures in C9orf72-repeats.

Background: Expansion of the C9orf72 hexanucleotide repeat (GGGGCC)·(GGCCCC) is the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Both strands of the C9orf72 repeat have been shown to form unusual DNA and RNA structures that are thought to be involved in mutagenesis and/or pathogenesis. We previously showed that the C-rich DNA strands from the C9orf72 repeat can form four-stranded quadruplexes at neutral pH.

Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif.

G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN).

Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72.

Background: An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures.

Methods: Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.

The role of loops and cation on the volume of unfolding of G-quadruplexes related to HTel.

In aqueous solutions containing sodium or potassium cations, oligodeoxyribonucleotides (ODNs) rich in guanine form four-stranded DNA structures called G-quadruplexes (G4s). These structures are destabilized by elevated hydrostatic pressure. Here, we use pressure to investigate the volumetric changes arising from the formation of G4 structures.

A Thermodynamic Study of Adenine and Thymine Substitutions in the Loops of the Oligodeoxyribonucleotide HTel.

Guanine-rich DNA oligodeoxyribonucleotides (ODN) can form four-stranded structures named quadruplexes (G4s), which are stabilized via the association of four guanine bases. Quadruplexes have a high level of conformational diversity depending on the molecularity, sequence, and the cation conditions of the G4 formation. Monomolecular G4 structures have nonguanine loops that usually consist of between one and four adenine and thymine residues.

Concentration-dependent conformational changes in GQ-forming ODNs.

Guanine-rich oligodeoxyribonucleotides (ODNs) can form non-canonical DNA structures known as G-quadruplexes, which are four stranded structures stabilized by sodium or potassium cations. The topologies of G-quadruplexes are highly polymorphic. H-Tel, an ODN with four consecutive repeats of the human telomeric sequence, [d(AGGGTTAGGGTTAGGGTTAGGG)], can assume different monomolecular G-quadruplex topologies depending on the type of cation present in solution.

Quadruplex formation by both G-rich and C-rich DNA strands of the C9orf72 (GGGGCC)8•(GGCCCC)8 repeat: effect of CpG methylation.

Unusual DNA/RNA structures of the C9orf72 repeat may participate in repeat expansions or pathogenesis of amyotrophic lateral sclerosis and frontotemporal dementia. Expanded repeats are CpG methylated with unknown consequences. Typically, quadruplex structures form by G-rich but not complementary C-rich strands.

A look at the effect of sequence complexity on pressure destabilisation of DNA polymers.

Our previous studies on the helix-coil transition of double-stranded DNA polymers have demonstrated that molar volume change (ΔV) accompanying the thermally-induced transition can be positive or negative depending on the experimental conditions, that the pressure-induced transition is more cooperative than the heat-induced transition [Rayan and Macgregor, J Phys Chem B2005, 109, 15558-15565], and that the pressure-induced transition does not occur in the absence of water [Rayan and Macgregor, Biophys Chem, 2009, 144, 62-66]. Additionally, we have shown that ΔV values obtained by pressure-dependent techniques differ from those obtained by ambient pressure techniques such as PPC [Rayan et al. J Phys Chem B2009, 113, 1738-1742] thus shedding light on the effects of pressure on DNA polymers.

Binding of a dimeric manganese porphyrin to serum albumin: towards a gadolinium-free blood-pool T1 MRI contrast agent.

As the first clinically approved gadolinium-based blood-pool MRI contrast agent, gadofosveset was designed to bind to human serum albumin (HSA) reversibly, extending the circulation time in the bloodstream. This valuable pharmacokinetic property required for vasculature imaging, however, raises the risk of release and accumulation of gadolinium in vivo. The binding of gadofosveset to HSA significantly increases the relaxivity at low field, which decreases drastically when the magnetic field increases, limiting the applications of gadofosveset at fields of 3 T and higher.

TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy.

The disease-associated r(GGGGCC)n repeat from the C9orf72 gene forms tract length-dependent uni- and multimolecular RNA G-quadruplex structures.

Certain DNA and RNA sequences can form G-quadruplexes, which can affect promoter activity, genetic instability, RNA splicing, translation, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia were recently shown to be caused by expansion of a (GGGGCC)n·(GGCCCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n-containing transcripts aggregate in nuclear foci possibly sequestering repeat-binding proteins, suggesting a toxic RNA pathogenesis.