Category Ranking
98%
Total Visits
921
Avg Visit Duration
2 minutes
Citations
20
Article Abstract
tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.
Download full-text PDF |
Source |
|---|---|
| http://dx.doi.org/10.1007/s12033-022-00596-9 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
Specific protein detection plays a crucial role in biological analysis and clinical diagnostics， serving as an essential tool for disease diagnosis， therapeutic monitoring， and biological research. However， conventional methods such as immunofixation electrophoresis （IFE） and western blotting （WB） suffer from complex workflows， time-consuming operations， and limited quantification capabilities owing to intricate staining and de-staining procedures. In addition， these traditional immunological detection methods require extensive manual handling and specialized expertise， while low levels of automation restrict their applicability to high-throughput or large-scale analysis scenarios.
View Article and Find Full Text PDFThe Effects of PLGA Nanoparticles Containing Different Growth Factors on Neural Stem Cell Differentiation and Their Transition Efficiency After Targeting With TRF.
CNS Neurosci Ther
September 2025
Center for Stem Cell & Gene Therapies Research & Practice, Kocaeli University, Kocaeli, Turkey.
Aims: Nanoparticle-mediated drug delivery systems are being investigated for the controlled release of drugs to treat neurodegenerative diseases (ND). We aimed to investigate the effects of poly(lactic-co-glycolic acid) nanoparticles (PLGA-NPs) containing different growth factors (GFs) on rat brain-derived neural stem cells (NSCs) in vitro differentiation, providing insights that may contribute to future approaches for treating Parkinson's disease.
Methods: Three different PLGA-NPs loaded with Brain-Derived Neurotrophic Factor (BDNF), Glial-Derived Neurotrophic Factor (GDNF), and Transforming Growth Factor beta 3 (TGF-β3) were developed and characterized in terms of size, zeta potential, encapsulation efficiency, and release profile.
Anti-Hair Loss Potential of Perilla Seed Extracts: In Vitro Molecular Insights from Supercritical Fluid Extraction.
Foods
July 2025
Research Group in Innovative Technologies for Sustainable Food (ALISOST), Department of Preventive Medicine and Public Health, Food Science, Toxicology and Forensic Medicine, Faculty of Pharmacy, Universitat de València, Avenida Vicent Andrés Estellés s/n, 46100 Burjassot, Spain.
Perilla seed has long been recognized in traditional diets for its health-promoting properties, but its potential role in hair loss prevention remains underexplored. This study compared three extraction methods-maceration (MAC), screw pressing (SC), and supercritical fluid extraction (SFE)-to determine their efficiency in recovering bioactive compounds and their effects on androgenetic alopecia (AGA)-related pathways. The SFE extract contained the highest levels of polyunsaturated fatty acids and tocopherols, while MAC uniquely recovered a broader range of polyphenols.
View Article and Find Full Text PDFThe Effects of Intermittent Fasting on Inflammatory Markers in Adults: A Systematic Review and Pairwise and Network Meta-Analyses.
Nutrients
July 2025
Department of Nutritional Sciences, University of Connecticut, Storrs, CT 06269, USA.
Intermittent fasting (IF) can improve inflammatory status, but its effects may be dependent on the mode of fasting. We performed a systematic review with pairwise and network meta-analyses to investigate the effects of different modes of IF on inflammatory markers in adults. Three database searches were conducted, including PubMed, Scopus, and Web of Science, from inception to June 2024.
View Article and Find Full Text PDFAre you talking to me? How the choice of speech register impacts listeners' hierarchical encoding of speech.
Imaging Neurosci (Camb)
April 2025
School of Computer Science and Statistics, ADAPT Centre, Trinity College, The University of Dublin, Dublin, Ireland.
Speakers accommodate their speech to meet the needs of their listeners, producing different speech registers. One such register is L2 Accommodation (L2A), which is the way native speakers address non-native listeners, typically characterized by features such as slow speech rate and phonetic exaggeration. Here, we investigated how register impacts the cortical encoding of speech at different levels of language integration.
View Article and Find Full Text PDF